Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA449
Clone ID YHA449
Vector pGT0pfs
Project baygenomics

Sequence tag YHA449
Sequence
GGGCCGGCGCGTTGCTCTCTGCTGGAGCTCCCGCCTGAGCTGCTCGTGGAGATCTTCGCGTCGCTGCCCGGCACCGACCT
GCCCAGCCTGGCTCAGGTCTGCAGCAGGTTCCGCCGAATCTTGCACACGGACACCATCTGGAGACGGCGCTGCCGCGAG
Sequence Type mRNA
Unitrap ID UNI6788

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124102359..124102517 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031811 (Fbxo31) NP_598526 F-box protein 31 Gene [Source:MGI Symbol;Acc:MGI:1354708]

 
Come back to gene ENSMUSG00000031811


For any suggestions or comments, please send an email to unitrap@crg.es