Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA002
Clone ID RHA002
Vector pGT0pfs
Project baygenomics

Sequence tag RHA002
Sequence
AACAAGAGCAGAAACCCGGGAAGAACGCATGGAGAGAAAGAGACGGGAAAAAATTGAACGGCGACAGCAGGAAGTGGAGA
CAGAGCTGAAAATGTGGGACCCTCACAATGATCCCAATGCTCAGGGCGATGCCTTCAAGACTCTGTTCGTGGCTAGAGTG
AACTATGACACAACAGAATCTAAGCTTCGGAGAGAGTTTGAGGTGTATGGACCCATCAAAAGAATCCACATGGTATACAG
TAAACGCTCTGGAAAACCCCGTGGTTATGCCTTCATCGAGTATGAGCATGAACGAGACATGCACTCCGCTTACAAGCACG
CAGATGGCAAGAAGATAGATGGCAGGAGGGTCCTCGTGGATGTGGAGAGGGGCCGGACTGTGAAGGGCTGGAGGCCCCGG
CGCCT
Sequence Type mRNA
Unitrap ID UNI6789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52636089..52647672 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es