Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181473
Clone ID OST181473
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181473
Sequence
TCTTGCCTCCCTTCCCCCATCCCTTAATTGAGGAACTAATCAANGGTCGGACNGGNAGCNTGGCATGGNTCCATATATCT
ACTGCCTCGAATCGATGAATTCGAGCTCGGNNCCCAGCAGCCCTGACCCACCTGGCGTCTCTGCTCATGTCTACAAGAAT
CTTCTATCCTGTCCTGTGCCTTAAGGCAGGAAGATCCCCTCCCACAGAATAGCAGGGTTGGGTGTTATGTATTGTGGNTT
TTTTGAGCGGNCCTATAACTGAACCAGGGG
Sequence Type mRNA
Unitrap ID UNI14564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45253803..45704915 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]

 
Come back to gene ENSMUSG00000023944


For any suggestions or comments, please send an email to unitrap@crg.es