Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181447
Clone ID OST181447
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181447
Sequence
GGAAGAGCAGCCTCCTGTTCGTANAGCTGNCCAACCCGCACTCAGGGGAAGGAGCCACATACTTAATTGATATGNGNCTT
CAACAGCCTGTTTGAAATAAAAGTTTTCAAGGAAAAACACCATTATTGGTTTATANCCTTNCCTTNTTAAATAAGGGGGC
ACTTCTGCACTTTGCCACNCCCATGGATCCATTGTTCCTGCTCCTTNANTATCTCCTAAAGGCTGGCAAAGAGGGGAAGT
ATCAGCCCTTGGACCAAGTCGTGGTCGATGACACGTTTCCAGATTGCACCTTGCTGCTGANATTTCCTGAGCTTGAAAAG
TCACTTCGGCATGTGACAGAGGAAAAAGAAGTGAACAGCAAGAAGTACTATAAGTACAGCTCANAGAAGACATTGAAGTG
GCTGGAGAANAAGGTCAACCAAACTGTGGNGGCACTAAAAGCTAATAATGNCAANGNTGGANCCCGGGTTCAAGTCATCA
GGGATATTT
Sequence Type mRNA
Unitrap ID UNI18068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62965436..62980239 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es