Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA041
Clone ID RHA041
Vector pGT0pfs
Project baygenomics

Sequence tag RHA041
Sequence
GCTGCAGATGGAGCAGGCTCTAGCCGGAGAGGCCCAGCCTGGGGAGAAACGGCGGCGCATGGCCTGCACGTGTCCCAACT
GCAAGGATGGGGAGAAGAGGTCTGGGGAGCAGGGCAAGAAGAAGCACGTGTGCCACATCCCGGACTGCGGGAAGACTTTC
CGGAAGACATCCTTGCTCCGGGCCCACGTCCGCCTGCACACTGGCGAGCGGCCCTTTGTCTGCAACTGGTTCTTCTGTGG
AAAGAGATTCACTCGGAGCGATGAACTCCAGCGACATGCTCGAACCCACA
Sequence Type mRNA
Unitrap ID UNI6798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96817092..96817517 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es