Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA043
Clone ID RHA043
Vector pGT0pfs
Project baygenomics

Sequence tag RHA043
Sequence
TAGCGGACGGTCGGGTCTTTCTGGTCTGAGTAGGGAATTGCTTTGTGTCTTCGGTCTCTGCAGAGGGAGGAAGCCTGAAG
AAGAATGGCCAACTCTAGTTCTCAACACATGGTCTGTGGGTCAGTGACATTTAGGGATGTGGCTGTTGACTTCTCTCAGG
AGGAGTGGGCCTGCCTGGATGCTACTCAGAAGGTCTTATACAGGAACATAATGTTGGAGACCTACAGCAACCTGGTCGCA
GTGGTGGGACGTTGCATTCCCAAGCCAGATCTGATCGTCTTACTAGAGCAGGAGAAAGAGCCCTGGATGGCTGTGAAGAA
AGAAACAGGCAGGCCGAGCCA
Sequence Type mRNA
Unitrap ID UNI6799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28516426..28526072 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es