Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST181110
Clone ID OST181110
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST181110
Sequence
AGACTGAGGACAGAATTTGGCTGTGACCGAGTGAAGCTGCTGGAGAGTGTAGTGGTTGGAGACATTGCGGAACTAAGGCC
TAACCAGGGAACACTCTNTTTGTTTACCANCGAAGCTGGAGGCATCTTAGACGACTTGATTGTAAGCAATACCTTCTGAG
GGGCACCGTGTATGNAGTATCCAATGCTTGGCATGCCGGGACAAGGACTTGNCTCTNATGCAGGACNNGGTCAAGGAGTN
CCCNAACAGGTCTCNTGNANGTAAGCCTGNNGGTGGTANAGAANGCCCTGANAGCTTTGCNAGGACCCACGGCANCTCAG
GNGNTACAGGCTGGGNTGACAAGGGATATGANGAAACTACCCTNCATNACNNGCGCTGGGATGGAGGTGNTCTGGGTGTT
TGGCTGTNAAGTGACCCNNTGTGTNTANACAGGANAAGANGGNGTNNTNAAATTGNTCCCAGCAANAGGGGCNTTTCCAC
TTGGGAACTNCCTCTGGCTGAAAAATCC
Sequence Type mRNA
Unitrap ID UNI25498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108200051..108202217 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es