Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA105
Clone ID RHA105
Vector pGT0pfs
Project baygenomics

Sequence tag RHA105
Sequence
AGAGAAGCAATTGTGCTGGTGTGGTGAGGATGCTGACGGTACAGTACCGAATGCACCAGGCCATCATGTGCTGGGCCTCG
GAGGCCATGTACCACGGGCAGCTTACTTCCCATCCCTCTGTGGCAGGACACCTCCTGAAGGACCTCCCAGGCGTGACTGA
CACAGAGGAGACACGTGTCCCGCTGCTGCTCATAGACACCTGCTGGCTGTGGGCTTCTGGAGCTGGAGGAGGAGGACAGC
CAGTCCAAGGGAAATCCG
Sequence Type mRNA
Unitrap ID UNI6816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3268299..3268797 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024831 (Ighmbp2) NM_009212 immunoglobulin mu binding protein 2 Gene [Source:MGI (curated);Acc:Ighmbp2-001]

 
Come back to gene ENSMUSG00000024831


For any suggestions or comments, please send an email to unitrap@crg.es