Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST180306
Clone ID OST180306
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST180306
Sequence
AGGCATTCATGGCTGAAGTGGAGGATCAGGCTGCTAGAGACATGAAGAGACTTGAAGAAAAGGACAAGGAAAGAAAAAAC
GTCNAGGGTATTCGAGATGACATTGAAGAGGAANATGACCANGAAGCTTATTTTCGATACATGGCAGAGAACCCACCTGC
TGG
Sequence Type mRNA
Unitrap ID UNI23909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106086226..106092486 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es