Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST180153
Clone ID OST180153
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST180153
Sequence
GGACTCTTGGCAGCCTGCAGGGNTTCAGGAAAAGTCAGCGTGATGACCAGAGTAAATCAGTGTCACGAGCAGGTCAAACA
CANATGANGAGGACCANGTTCCTATCCATCGCTGAAGCCTGGAGCACCCTCTTAAAATGAGTTCCCTCTTTATTATATCT
GGGGGGAGTAGAATGG
Sequence Type mRNA
Unitrap ID UNI17748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 135584722..135585419 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051998 (Lax1) NM_172842 lymphocyte transmembrane adaptor 1 Gene [Source:MGI Symbol;Acc:MGI:2443362]

 
Come back to gene ENSMUSG00000051998


For any suggestions or comments, please send an email to unitrap@crg.es