Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA164
Clone ID RHA164
Vector pGT0pfs
Project baygenomics

Sequence tag RHA164
Sequence
AGAAGGAGATGGAAAGTATTTGAAGCTTCCACAGCTGGTTGATATGGCTGCTCAGATCGCTGATGGCATGGCGTATATTG
AAAGAATGAACTATATTCACCGAGATCTCCGAGCTGCTAATATTCTTGTAGGAGAAAATCTTATATGCAAAATAGCAGAT
TTTGGCTTAGCAAGATTAATTGAAGACAATGAATACACGGCAAGACA
Sequence Type mRNA
Unitrap ID UNI5051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32961430..32963276 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es