Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST179891
Clone ID OST179891
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST179891
Sequence
GGCCTCAGTAGTTGTGGNACAAATCCCTGTGCGTGAGGAGTTCTTTCTCTGTGGTGGAGTTGAAACCAAGATCATAAAAT
GTGGGCCCTGGACTAACCTCTTTGAGAAACAAGACGTCAGCAAGCCAAAACAGCTTATCTTCATCATTCCCGGNAACCCA
NGCTATTCCAGCATTCTACGACCCTTTTGCGAAGGCCTGGCTCACT
Sequence Type mRNA
Unitrap ID UNI22803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8227410..8227565 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037669 (1110057K04Rik) NM_172401 RIKEN cDNA 1110057K04 gene Gene [Source:MGI Symbol;Acc:MGI:1916082]

 
Come back to gene ENSMUSG00000037669


For any suggestions or comments, please send an email to unitrap@crg.es