Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RHA173
Clone ID RHA173
Vector pGT0pfs
Project baygenomics

Sequence tag RHA173
Sequence
AATTCAAAAGAGAGAAGCGGTCCGAAGAAGGGAAGGCTATGAGCTTAAGGGCTAAGACGTGTCCGCAGCGACGGGAGATG
GCGTCGGCCACCTCAGGTCCCAGG
Sequence Type mRNA
Unitrap ID UNI221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134185856..134185953 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es