Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST179660
Clone ID OST179660
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST179660
Sequence
GACTGAGAAATTCATTTGCAAATTGCCCGACAAAGGTAAAAAGATCTCAGGACACAGTTGCCAAACTGAAAGCTGCCATT
TCAGAACGTGAAGAGGTTAGAGGGAGAAGTGAACTGTTTCATCCTGTTAGTGTAGACTGTAAGCTAAGGCAAAAAGCAAC
CACAAGAGCATGACACCGATGTAGACAAGGCCCAGAGTTCTGACCTGATGCTTGATACTTCATCATTAGATCCTGACTGT
TCCTCAATAGACATTAAGTCATCTAAATCAACCTCAGAAACACAGGGACCTACACATCTCACTCACAGAGGCAATGAAGA
GACTTTGGAGGCTGGCTACACAGTAAACAGCAGCCCAGCTGCCCACATCCGAGCCCGGGCGCCCTCATCCGAAGTTAAGG
AGCATCTCCCCCAGCACTCTGTTTCAAGTCAAGAGGAAGAGATCTCCAGCAGCATCAACAGTCTCTTCATCACTAAATTG
CAAAAAATCACAATTGCAGACCAGAGTGAACCCTCAGAAGAAAACACCAGCACTGAGAACTTATTGGG
Sequence Type mRNA
Unitrap ID UNI21491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71331079..71331611 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032199 (Grinl1a) NM_178602 glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene [Source:MGI Symbol;Acc:MGI:107282]

 
Come back to gene ENSMUSG00000032199


For any suggestions or comments, please send an email to unitrap@crg.es