Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA131
Clone ID YHA131
Vector pGT0pfs
Project baygenomics

Sequence tag YHA131
Sequence
TCAAGTTTCTCTCTGTAACTCAGGTGACCTGAGTGTTTCTATGTGTTGCGTTCTTACTGTCTTCAGTGAGTGCTGCGAGG
TA
Sequence Type mRNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176858953..176859034 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es