Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST179541
Clone ID OST179541
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST179541
Sequence
GACTGAGGGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGCAAAAGCTGCTGCTCCTGCTGCCCCGAGGGCTGTGCG
AAGTGCTCCCAGGGCTGCATCTGCAAAGAGGCTTCCGACAAGTGCAGCTTGCTGNNCCTGAAGGGGGGCGGAGGGGTNCC
CACATCTGTGTAAATAGACCATGNAGAAGCCTAACCTTTTTTGTACAACCCTGACTCGTTCTCCACAACTTTTTCTATAA
AGCATGTAACTGACAATAAAAGCCGTTGACTTGATTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96697054..96697464 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031762 (Mt2) NM_008630 metallothionein 2 Gene [Source:MGI Symbol;Acc:MGI:97172]

 
Come back to gene ENSMUSG00000031762


For any suggestions or comments, please send an email to unitrap@crg.es