Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST179417
Clone ID OST179417
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST179417
Sequence
GTATATTGTGATGGGCCACATCTACCATAANAGACGGCAGCTCCCCAGTGCGCTGCTCCAGGTCCTAAGGGGGCGCCTGC
GTNCAGGANACGGACTGATCCGGGGTAGCAGNAGNTACGTGAAGAGGTTTAACCGAAAGCGGTAGTGGCAAGTTCGAGGT
GCCACCCACACCCAGTGCATTNGAACTTGGCACTTGGNGTCGGTCTTCACGTGACGGGAAGCTTCTGTGAAACCGGGCTA
CCTTATGGACTCCGTGTGCGGCTTAGCTGTCACTTTATCTACAAAATGCTGACAGGTGTGCTTCAGGACACTGTGCGAAA
GTCCCTCGAGGGCAGTCATGCACACAACCCAGACACCAGACCCCGTGGGCCAACAGATCACACCATTTTTGCTGTTTTTA
AGTTATTTTAATTTAATACATTCCCCCCAGTGGAGACAGTTCACAAAACAGTTCTCGAATTTAAATATACAACTTTGACT
AGTATCTAT
Sequence Type mRNA
Unitrap ID UNI13736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106890906..106891394 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078607 (1810010H24Rik) RIKEN cDNA 1810010H24 gene Gene [Source:MGI Symbol;Acc:MGI:1916316]

 
Come back to gene ENSMUSG00000078607


For any suggestions or comments, please send an email to unitrap@crg.es