Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST179299
Clone ID OST179299
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST179299
Sequence
GACTGAGAAGCAAACTGCACCTACTTCAAATTCTTCACCACGGGGGAAAATGCGCGCATCTTCCAGCGAACCACCAAGAA
AGGCCTGCTGCTCTTTGTCAGCCTGGAGGTGTTCCGGCATTCCGTAGGAGCCCTGCTGCAGGGAGTCAACCCTGAGACCC
CTCCAGCTCCACGCCTGGCCTATGAGTATTCCTGGTCCTTAGGCTGTGGTGTAGGCGCTGGTCTAATCCTGCTGCTGGGG
GGAGTCTGTTTCCTCCTGCTCACCTTGCCTTCCTGGCCCTGGAGGTCACTGTGCCCCAAGTGGGGTGGCCCAACCGCCTA
GAGCGTGCTTTCTGAAGACATCTGCCAACCCTGTCTCAGTTTCCAGCTTTCTCCTCAAGAGTTTTCATNTCTCTTNTAGA
GAAATGGGTTTTCCCACTNTGGGGAGCCCATTTNACAAAATGTNTTGGNCCCTCCCTAATNTTNTCCCTGAAAATAATGC
TTTNGGGGGGTAGGGGAATG
Sequence Type mRNA
Unitrap ID UNI21654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3431154..3435837 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078815 (Cacng6) NM_133183 calcium channel, voltage-dependent, gamma subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1859168]

 
Come back to gene ENSMUSG00000078815


For any suggestions or comments, please send an email to unitrap@crg.es