Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST178763
Clone ID OST178763
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST178763
Sequence
AGACTGAGGAGCTGGAGAGTCTTTCGAGGAGCTGCCGCCATACCTTCGCCAACTGTCTAGTGACGATGCCAATGTGCTTG
TGTGGCACATGCTCCTGCTGCCAGACCAGCTTCCCTATGGCCTCAAAGCCTTCCAAGTGCGGATTGATTTCCCCAGGGAG
TATCCATTCAAGCCTCCCACTTTGAGATTCACCACCAAGATCTACCACCCCAACGTCAGGGAGGATGGTCTGGTGTGCCT
GCCCCTCATCAGCAATGAGAACTGGAAGCCTTACACCAAGCCTTATCAAGTCTTGGAGGCCCTCAATGTGCTGGTGAGTA
AACCGAATCTGGAAGAGCCTGTGCGTCTGGAACTTGCTGACCTCCTGACTCAGAACCCGGAGATGTTCAGGAAGAAGGCA
GAAGAGTTCACCCTTAAATTCGGAGTGGACCGGCCCTCTTAATTCTGTTCTGAAGCCTGGATCGTTCTGCTTANCAGATG
GATATCACCGACTGGTGCCCGAGGCCTTGGGAAGCTCACCCTGTGCCTAAGTTTTA
Sequence Type mRNA
Unitrap ID UNI23175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84642934..84649405 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027078 (Ube2l6) NM_019949 ubiquitin-conjugating enzyme E2L 6 Gene [Source:MGI (curated);Acc:Ube2l6-001]

 
Come back to gene ENSMUSG00000027078


For any suggestions or comments, please send an email to unitrap@crg.es