Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST178597
Clone ID OST178597
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST178597
Sequence
ATCTTCGGAGGCACCTGGAGCTAAGTTACCAAATGGAAAGAAAGGGACCCACGTAAGAAAAATAGCACATTTTAATGTAG
ACTCCGCCCTTGGGAAAGATAACCACCATCTGCTCTAATCATGTAGACGTACTGCCGCCTGGTTTCTNTGTTACAATAAA
ATTACTATAGACCCAAAAAAAAGAAA
Sequence Type mRNA
Unitrap ID UNI25533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98388035..98475348 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031672 (Got2) NM_010325 glutamate oxaloacetate transaminase 2, mitochondrial Gene [Source:MGI (curated);Acc:Got2-001]

 
Come back to gene ENSMUSG00000031672


For any suggestions or comments, please send an email to unitrap@crg.es