Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA153
Clone ID YHA153
Vector pGT0pfs
Project baygenomics

Sequence tag YHA153
Sequence
GGCACCCCTCGGCTGGAGCGGAGGAGTGAGGGCGGGTCTGATGGGAGCGCGGCTGAGGCGGAGCCGCGGGCTCTGGAGAA
CGGAGAGGCAGATGAGCCCTCCTTCAGCGACCCCGAGGATTTCGTAGACGACGTGAGCGAGGA
Sequence Type mRNA
Unitrap ID UNI6842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140895637..140895778 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es