Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST178347
Clone ID OST178347
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST178347
Sequence
TTGCGGATCTCTCAANGATCGGACAGNAATGNGGGTNCAACTACGTTCTTTANCCGGNNCATCTAGAAACACACATGTGG
AAGATGATGATGTTGTATTTATTGAATCAGTACAGCCTCCAATTTGTGCTCCAGCAATACCTAATGAAAGAAACTTTGTA
TTTGCTTCCTCAAAACATGAAAATCCNNCAGGAACTGATTCCACAATTTCCCCTTCTTGGAGAGATTTGACTTCTCAGAA
GGGAAATCTATGTGAAACAATTGTAATTGATGATGAAGGGGACACAGACACAAATGGAGGGGAGGAGAAAAATCCTACCG
ACTTTATTGAATGGGGACCGAATGGAAATAAAAGTAGTACCAAAAATGNGGATTTCCCCATTGCCAGTCTATCAAGAAGC
ANGACCAAGACTGCNGTAGGACCTTTTAATCCCGGNAGGATCGATGTCACGGATGCGTTTCA
Sequence Type mRNA
Unitrap ID UNI17408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57423018..57423624 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040123 (Zmym5) NP_659091 zinc finger, MYM-type 5 Gene [Source:MGI Symbol;Acc:MGI:3041170]

 
Come back to gene ENSMUSG00000040123


For any suggestions or comments, please send an email to unitrap@crg.es