Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST178080
Clone ID OST178080
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST178080
Sequence
GACTGAGACATGGAATCTAAAGAGTATTTGTTAAAGTCAGAAAGAAGGACCTGGAACGGCTGACGACGGAAGTGATGCAA
ATACGGGACTTCTTACCCAGAATACTAAATGGGGAGTTACTGGAAAGTTTCCAGAAATTAAAGATGGTAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32170206..32170355 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002076 (Hsf2bp) heat shock transcription factor 2 binding protein Gene [Source:MGI (curated);Acc:Hsf2bp-001]

 
Come back to gene ENSMUSG00000002076


For any suggestions or comments, please send an email to unitrap@crg.es