Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST177143
Clone ID OST177143
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST177143
Sequence
GACTGAGGTGGGGTCTTTCAAGAACCTTGTAGGCCCTTTGGGCTCGGGTCCAGGGCACTCCGACCACCATGCGCGACAGG
ACCCACGAGTTGAGGCAGGGGGATAACATCTCANACGATGAANATGAGGTTCGAGTCNCGCTGGTGGTGCACTCAGGTGC
TGCCCGGTTGGGCAGCCCGGACGACGAGTTCTTCCAGAAGGTGCAGACAATTCGGCAGACTATGGCCAAACTGGAGAGTA
AAGTCCGGGAGTTGGAGAAACAGCAGGTCACCATCCTGGCCACGCCTCTTCCCGAGGAGAGCATGAAGCAGGGCCTGCAG
AACCTGCGAGAGGAGATCAAACAGCTGGGGAGAGAGGTCCGGGCGCAGCTAAAAGCCATAGAGCCCCAGAAGGAGGAAGC
TGATGAGAATTACAACTCAGTCAACACAAGGATGAAGAAAACCCAGG
Sequence Type mRNA
Unitrap ID UNI25551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985506..134987157 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030805 (Stx4a) NM_009294 syntaxin 4A (placental) Gene [Source:MGI (curated);Acc:Stx4a-001]

 
Come back to gene ENSMUSG00000030805


For any suggestions or comments, please send an email to unitrap@crg.es