Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST177139
Clone ID OST177139
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST177139
Sequence
GACTGAGATTGGTGGATCCTTTAATTCAAGTAAAATGGAGACCGAACAGCCAGAAGAAACCTTCCCCAACACCGAAACCA
ATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAGCAAGCCTTTAAAAGATCTAGAAATACTGATGAGATG
GTTGAATTGCGCATTTTGCTTCAGAGCAAGAATGCTGGAGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCG
TACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCG
Sequence Type mRNA
Unitrap ID UNI8590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58499114..58501780 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021546 (Hnrnpk) NP_079555 heterogeneous nuclear ribonucleoprotein K Gene [Source:MGI Symbol;Acc:MGI:99894]

 
Come back to gene ENSMUSG00000021546


For any suggestions or comments, please send an email to unitrap@crg.es