Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST177033
Clone ID OST177033
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST177033
Sequence
TGAGTGACGTATGACTTCTACACCCAACATGAGTGACATTTCCTGCAAAAAACGGGATGACTATCTGGAATGGCCCGAGT
ATTTCATGGCAGTGGCCTTCTTGTCGGCACAAAGAAGCAAGGACCCAAGTTCCCAGGTGGGGGCCTGCATTGTGAACACA
GAAAACAAGATTGTTGGGATCGGGTACAATGGCATGCCAAATGGGTGCAGTGATGACCTGTTGCCTTGGAGGAGAACAGC
AGAAAATAAGCTGGATACTAAATATCCTTATGTGTGCCATGCCGAGCTGAACGCCATCATGAACAAGAACTCGGCTGATG
TGAAGGGCTGCAGCATGTACGTCGCCTTGTTCCCGTGTAACGAATGTGCTAAACTCATCATCCAGGCAGNTNANAAGNGN
NCCTNCNNTGGNTTNNACACGNNCNGCGTGGGAGCTCNGTGGCTCACTCGGCTCATTC
Sequence Type mRNA
Unitrap ID UNI25559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 49197011..49222788 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031562 (Dctd) NM_178788 dCMP deaminase Gene [Source:MGI Symbol;Acc:MGI:2444529]

 
Come back to gene ENSMUSG00000031562


For any suggestions or comments, please send an email to unitrap@crg.es