Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST177017
Clone ID OST177017
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST177017
Sequence
AGGAGCACCTGAGCCTCAGCTCCTGCCGGCAGGAGCCCCCGAATGCTGGACCCAGCCACCCATGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54785356..54785416 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es