Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST176856
Clone ID OST176856
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST176856
Sequence
GACTGAGGGACTAGTGCCGTTCAAAGACGTGGCCATTGATTTTACCCAAGAAGAATGGAAGCAACTGGATCCTACTCAGC
GGAACCTATATAGGAATGTGATGCTAGAAAACTACAACAACTTAATCACAGTAGGCCCGCCACTCACCAAACCTGAAGTG
ATTTTCAAGTTGGAGCAAGAGGAANAGCCTTGTGTGGTGGAGAGAGAAGTGCTGTGGAGACCCTGTCCAGGTTAGTGTGT
GTG
Sequence Type mRNA
Unitrap ID UNI13145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30722606..30723089 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es