Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST176704
Clone ID OST176704
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST176704
Sequence
TGAGGAGCAGCTCAGAGCTGAGGAAGGAGAAATCCCGTGATGCCGCGAGGTGCCGGCGCAGCAAGGAGACGGAGGTCTTC
TATGAGTTGGCTCATGAGTTGCCCCTGCCTCACAGTGTGAGCTCCCACCTGGACAAAGCCTCCATCATGCGCCTGGCCAT
CAGCTTCCTTCGGACACATAAGCTCCTGTCCTCAGTCTGCTCTGAAAATGAATCTGAAGCTGAGGCCGACCAGCANATGG
ATAACTTGTACCTGAAAGCCTTGGAGGGTTTCATTGCTGTGGTGACCCAAGACGGTGACATGATCTTTCTGTCGGAAAAC
ATCAGCAAGTTCATGGGACTTACCCAGGTAGAACTAACAGGACACAGCATCTTTGACTTCACTCATCCTTGCGACCATGA
GGAGATCCGTGAGAACCTGACTCTCAAAAACGGCTCTGGTTTTGGGAAGAAGAGCAAAGACGTGTCCACCGAGCGTGACT
TCTTCATGAGGATGAAGTGCACAGTCACCACC
Sequence Type mRNA
Unitrap ID UNI25566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86531030..87208775 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024140 (Epas1) NM_010137 endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]

 
Come back to gene ENSMUSG00000024140


For any suggestions or comments, please send an email to unitrap@crg.es