Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST176619
Clone ID OST176619
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST176619
Sequence
TGAGGAGCTCTTGGCTAGAGGAAGTAGAGGGGCCGTGGGATGTGGAGAGCCGAAGGCTGACTCCAGGAGAGCAGAACAGA
GAGCTGCCAGCGAACAGACGCAGGTAGACGAGCCCGTACCTTCCAGGATGAGCAGTGCTGCCCCTGCTAAGAAACCTTAC
CGTAAGGCGCCTCCAGAGCACCGAGAGCTACGCCTGGAGATTCCCGTGTCCCGGNTCGAGCAAGAGGAGTCCCTGACTGA
CGCAGAGCGGATGAAGTGAGTATTGGCTGCCCGTCCCTGGACTGTGTGCTGTGCCCTTTCACTCCCTGCTGGGCTGTGGG
GACTCCNAGGCTCCTCCTCACATTTGGCCTTCCGGCATANTGCTGTGACCTGCAGTTAGAACCATACACTGGAATTACAA
AC
Sequence Type mRNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46399189..46401929 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es