Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX232
Clone ID NPX232
Vector pGT1dTMpfs
Project baygenomics

Sequence tag NPX232
Sequence
AAACCCGGTACAAGATGGCGGCAATAGCGCAGTGGCGGCGCGTAGGAGGCG
Sequence Type mRNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8972598..8972649 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es