Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST176498
Clone ID OST176498
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST176498
Sequence
GACTGAGGACTTACAAGCAGCGATTGGCGCCTATTATGACTTCGAGAGCCCAAATATCAGTGTGCCCTCCATGTCCTTTG
TTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCCCCTGATACCCAGTTCATAAAAACTTGGCGGATACAGAATTCT
GGAGCAGAGGCCTGGCCTCCAGGGGTTTGTNTTAAATATGTCGGGGGAGACCAGTTTGGACATGTGAACATGGTGATGGT
GAGATCACTAGAGCCCCAAGAGATNGCAGACGTCAGCGTCCAGATGTGCAGTCCCAGCAGAGCAGGCATGTACCAGGGAC
AGTGGCGGATGTGCACTGCTACTGGACTCTACTATGGAGATGTCATCTGGGTGATTCTCAGTGTGGAGGTGGGTGGACTT
TTAGGAGTAACGCA
Sequence Type mRNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27905130..27931006 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es