Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST176374
Clone ID OST176374
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST176374
Sequence
CTTGGCCCAGCTCTCAGCCACCATTTTTCGAAAGGAAGGCCTACAAGGATGGCCTCAGTTCATGAACCTTCTTCAGCACA
GCACTCATAGTTCCCATAGCCCCGAGAAAGAGGTGGGACTTCTGCTGCTGAGTGTGGTGGTGTCTTCCCAGCCCGAGGCT
TTTTTAGCCCACCNGCACCGAGCTGCTCCTGCTTCTGACTCCCAATCTAGGATTACAAGCTTGTACCACCACACTCAGCT
ANCATTANGACTTAAAANGGAATACGGAACTGATCGATTAGGTGAATACATGAAACATATT
Sequence Type mRNA
Unitrap ID UNI25570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56252947..56253228 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002319 (Ipo4) NM_024267 importin 4 Gene [Source:MGI (curated);Acc:Ipo4-001]

 
Come back to gene ENSMUSG00000002319


For any suggestions or comments, please send an email to unitrap@crg.es