Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB486
Clone ID BGB486
Vector pGT1Lxf
Project baygenomics

Sequence tag BGB486
Sequence
GGTTGTGTGGCCTCCATTGTTCAGGATTAAGCGAGCCATG
Sequence Type mRNA
Unitrap ID UNI6854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280126..90280165 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es