Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB500
Clone ID BGB500
Vector pGT1Lxf
Project baygenomics

Sequence tag BGB500
Sequence
GGGGACACGCCGGCCAGACGTTTCTCAGCCAGCCTAGTTCTTCCCAGCGAAGAGCGGTTGTGTGGCCTCCATTGTTCAGG
ATTAAGCGAGCCATG
Sequence Type mRNA
Unitrap ID UNI6854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280072..90280165 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es