Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST175675
Clone ID OST175675
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST175675
Sequence
ACTGAGATTGTCACACCTGAAAGTGGCACATCTGGCTCAGCTGATGAGGAAGAACAGGCAGATCTTGCTGAAGAAATGGA
GAATGAGATTTGCAGAGTCTGGGATATGTCCATGGACGAGGATGTGGCTTTATTTCTCCAAGAATTTAAGGCTCCTGACA
TATTCATGGGAGTGCTGGCCAAATCCCCGTGTCCCCGATTAAGAGAAATCTGTGTGGGAATTTTAGGGAATATGGCTTGT
TTCCGGGAGATATGCGAGTCCATCAGCAAGAACGAGGATCATGGGCAGGTGCTGCTGCAGTGTTTGTGTGACTCAGACCC
ACCCACCCTGCTGGAAACTTGCAGGGTTGTC
Sequence Type mRNA
Unitrap ID UNI25580

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53959354..53964349 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006763 (Saal1) NP_084509 serum amyloid A-like 1 Gene [Source:MGI (curated);Acc:Saal1-001]

 
Come back to gene ENSMUSG00000006763


For any suggestions or comments, please send an email to unitrap@crg.es