Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST175239
Clone ID OST175239
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST175239
Sequence
GACTGAGAGACCAGAAATAGCTGGAATGCTATCTTAAACCAAAAATCTATTTAAATACTTACTTAATGCTGCTTAAATGA
AGAAAGATATATTAACTATCCAAAACTCCACCTGATAACTATCCCATTGAGACACTGGACAACATGTCGCTCAATCCAAG
TCGACCATCTTCATCAGAGTTGGNGGAACTTCATGTTTTTTATGTCCCTGAAGGATCGTGGAACTATAAATTAAATACTA
TTTCAATAGAAGTTATTAACAACTTTATTTCTGCTGGATTTATAAGAGTATCTCCTCAGCTTACCTTACAAGCTCTGAGG
GAGCGTCTTGGGGAGTTTCTTGGTGTAGATGCTGTTGCAGAAAAATTTTTGTTTCTGAAATGCATTGGAAATAATTTAGC
TGNGGTAAAGGAAAAGCAAGAATCANAACTGAAACTCAAATCATT
Sequence Type mRNA
Unitrap ID UNI25584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146150489..146156809 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028188 (Spata1) NM_027617 spermatogenesis associated 1 Gene [Source:MGI (curated);Acc:Spata1-001]

 
Come back to gene ENSMUSG00000028188


For any suggestions or comments, please send an email to unitrap@crg.es