Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST175021
Clone ID OST175021
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST175021
Sequence
TTTTCCAACTACTGCACTGGAATGGAAGCCTGAAAGCCCTCCGTGAAACAAAGTGCTCTCGACAGGAAGTCATCTCCTAC
TATTCCCAATATTCTTTAGATGAAAAGATGCTGTAGCCACATGGCCCTGGACTGGATTATGAAGGAGCTGTGAATCACCA
GGAATTCTCTCTCAAGAGCTGCTGTGCAGCCCTAGGGCAGCTGGAGGAAGCCAGGAAGGCTGGACAAGAACTACGATTTT
ACAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17591237..17594253 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es