Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST174738
Clone ID OST174738
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST174738
Sequence
GACTGAGGACACAGCCAAAAGATACAACATAATGGCTTTTAATGCAGCCGATAAAGTCAACTTTGCTACCTGGAACCAGG
CACGGCTGGAGCGAGATCTGAGCAACAAGAAGATTTACCAGGAAGAAGAGATGCCAGAGTCCGGTGCAGGCAGTGAATTC
AACCGCAAGCTTAGGGAGGAGGCGCGCCGGAAGAAGTATGGCATTGTCCTAAAGGAGTTTCGGCCTGAGGATCAGCCTTG
GCTACTCCGTGTCAATGGCAAATCAGGACGGAAGTTCAAAGGCATTAAGAAAGGCGGGGTAACAGAGAACACAGCCTACT
ACATCTTCACACAGTGTGCTGATGGTGCCTTTGAGGCTTTCCCTGTACAGAACTGGTACAATTTCACACCACTGGCCCGA
CACCGNACACTCACTGNTGAGGAAGCCGAGGAGGAATGGGAGAGGAGGAACA
Sequence Type mRNA
Unitrap ID UNI24859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57146408..57149181 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002658 (Gtf2f1) NM_133801 general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]

 
Come back to gene ENSMUSG00000002658


For any suggestions or comments, please send an email to unitrap@crg.es