Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0383
Clone ID DC0383
Vector pGT1lxr
Project sanger

Sequence tag DC0383
Sequence
CAACTCGTCCAACTGACAAGCCTCTGCGACTGCCCCTCCAGGATGTCTATAAAATTGGAGGCATTGGCACTGTCCCTGTG
GGCCGAGTGGAGACTGGTGTTCTCAAGCTCGGCATGGTGATTACATTGGCTCCAGTCAATGTAACAACTGAAGTCAAGTC
TGTTGAAATGCACCATGAAGCTTTGAGTGAAGCTCTTCCTGGGGACAATGTGGGCTTCAATGTAAAGAACGTGTCGGTCA
AAGATGTTAGACGAGGCAATGTTGCTGGTGACAGCAAAAACGACCCACCAATGGAAGCAGCTGGCTTCACTGCTCAGGTG
ATTATCCTGAACCATCCAGGCCAAATCAGTGCTGGCTACGCTCCTGTTCTGGATTGTCACACAGCCCACATAGCATGCAA
GTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTG
Sequence Type mRNA
Unitrap ID UNI674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78326879..78327490 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]

 
Come back to gene ENSMUSG00000037742


For any suggestions or comments, please send an email to unitrap@crg.es