Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST174029
Clone ID OST174029
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST174029
Sequence
CTCAGCTTTACTCAGAGTTANTGCNCCTGGACTTGCTTNNTGGTNCTGAATNTTANTACTGAGATGCAGATCCCTCNAAC
CACANAGTTCTAGGTTGNGTNTGNNNGTNCTCAGTCTCTACCTTATTTTGCTGCTAAATTCAACCTCAGNGTCACTGATG
CATCTANAAGGCTGTGTGGCTTCCTCAAAAGTCTTGGGGTGCACTATGTATTCGACACCACAATCG
Sequence Type mRNA
Unitrap ID UNI25608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121105907..121106279 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000056 (Narf) NM_026272 nuclear prelamin A recognition factor Gene [Source:MGI (curated);Acc:Narf-001]

 
Come back to gene ENSMUSG00000000056


For any suggestions or comments, please send an email to unitrap@crg.es