Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGA637
Clone ID BGA637
Vector pGT2Lxf
Project baygenomics

Sequence tag BGA637
Sequence
GCGGCGAAGGGGGCGGAGGAAGAGCGCGGCTGGACGCGGTCCCGCACCGCGCGTACGCAGGGCCGCGGGGGTTCTTTCGC
GCCGACTGGAGTAGCAACTGCGTCTGCAGCCGCGGCAGCGGGTTTGGGTGAAGGGCTCGCCAGACGCAGTGCCGCTAGCC
CGGGGGACACGAG
Sequence Type mRNA
Unitrap ID UNI6873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106078296..106078468 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es