Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGA188
Clone ID BGA188
Vector pGT1Lxf
Project baygenomics

Sequence tag BGA188
Sequence
TGCTCCGCCGGGAAGCGGGTCGGCTGCAGCGAGCGGGCGGAG
Sequence Type mRNA
Unitrap ID UNI2948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 127540068..127540109 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074238 (BC002199) NM_145964 BC002199 protein [Source:UniProtKB/TrEMBL;Acc:Q99LV9]

 
Come back to gene ENSMUSG00000074238


For any suggestions or comments, please send an email to unitrap@crg.es