Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST173915
Clone ID OST173915
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST173915
Sequence
AAAAGAATGTGGGGGCANTTTAGGAACACATAGCTGCCTCTNTCAGCATCCCTTCCGAGAAACAGCNGCTCATGTACCAN
GNNCNGGTCCTACAAGACGACAAGAAGCTCCAGGAGTACAACGTTGGGGGAAAGGTTATTCACCTGGTGGAACGGGCTCC
TCCTCAGACTCAGCTTCCTTCTGGAGCATCTTCTGGGACAGGCTCTGCCTCAGCAACTCATGNTGGGGCACCCCTGCCTG
GCACTCGGGGCCCTGGGGCTTCTGTTCATGACCGGAATGCCAACAGCTATGTCATGGTTGGAACCTTCAATCTTCCTAGN
GACGGCTCTGCTGTGGATGTTCACATNAAACATGGAACAGGCCCCAATTCANAGTGAGCCCCGGNTCCGGCTGGTGATGG
CTNAACACATTGATTANGGATATACAGACCTTACTGTCCCGGGATGGAAGTGTNAGAGGGGGAAACCCAAGCTCAGGCCA
Sequence Type mRNA
Unitrap ID UNI25613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35275319..35277205 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024392 (Bat3) NM_057171 HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

 
Come back to gene ENSMUSG00000024392


For any suggestions or comments, please send an email to unitrap@crg.es