Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0374
Clone ID DC0374
Vector pGT1lxr
Project sanger

Sequence tag DC0374
Sequence
TGACCATTGGCCCCTCTGTACTCTCTGCTGCCAGAGATGACATCAGCAAGCTCAGAAACACACTTCGCTTTCTCTTGGGA
AATTTGACCGGTTTTAACCCCGAGACGGATTCTGTTCCTGTGAAGAATATGTACGTCATAGACCAGTATATGCTGCACTT
AATTCAGGATTTTGCGACAAAGATTACTGATTCATACAAACAGTATGACTTTGGGAAAGTTGTCAGGCTGTTGAAAGCCT
TCTACACCAGAGAACTGTCCAGCTTTTACTTCAGCATAGTCAAGGATAGGCTCTACTGCGAAAACGAGAAGGATCCCAAG
CGCCGCTCGTGTCAGACAGCATTGGCAGAAATTTTGGATGTGTTGGTCCGTGCTTTTGCCCCCATTCTTCCTCACTTGGC
AGAAGAGGTGTTTCAGCACATTCCCTATGTTACAG
Sequence Type mRNA
Unitrap ID UNI678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 187114365..187119483 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026618 (Iars2) NM_198653 isoleucine-tRNA synthetase 2, mitochondrial Gene [Source:MGI (curated);Acc:Iars2-001]

 
Come back to gene ENSMUSG00000026618


For any suggestions or comments, please send an email to unitrap@crg.es