Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST173272
Clone ID OST173272
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST173272
Sequence
TGAGGGACCACAGATGGNATGCTTTGCCATCCTGGNCCTCCTACGACAGTGAGCTGACCCAAACTGAGTACTCANCCCAG
CTGACACAGCGCCTGTGGGAGGCCGAGGACATGGTTCAGAAGGTACATGCCCACAGCTCGGAGATGGAGGCTCAGCTGTC
TCAGGCCCTGGAGGAGCTTGGGGTTCA
Sequence Type mRNA
Unitrap ID UNI2702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140608742..140620009 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029554 (Mad1l1) NM_010752 mitotic arrest deficient 1-like 1 Gene [Source:MGI (curated);Acc:Mad1l1-001]

 
Come back to gene ENSMUSG00000029554


For any suggestions or comments, please send an email to unitrap@crg.es