Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST173265
Clone ID OST173265
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST173265
Sequence
TTGAGGAGCAGAAGATCCAGNTTCGGACATCCCGCCTCACCTGCAGTGGGAGGTGTTGGATGGGCTGTTGGCTGAATATG
GGACAGTGGAGAACGTGGAGCAAGTCNACACATATACNGAAACTGCCGTTGTCAACCGNCACCTATATGACAAGAGAANA
GGCAAAGCTNNCTATTGAGAAGCTCAGNGGGCATCAGTTTGAGGACTACTCCTTCAAGATTTCCTACATCCCCGATGAAG
AGGTGAGCTCTCCTTCACCCCCTCATCGTGCCCGGGAACAAGGCCACNGGGCCCNGGAGCTCTNCTCAGGCCAAACAGGA
TTGATTTCCCNCTNNGAATCCTGGTCCCCACCCATTTTGTT
Sequence Type mRNA
Unitrap ID UNI18275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22081869..22089185 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es