Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB202
Clone ID BGB202
Vector pGT1Lxf
Project baygenomics

Sequence tag BGB202
Sequence
ACGATACACCAATCAGACCTTTGATAAGGTGATGGGTCCCATGTTGGATGCTGCTACCAGAAAACCCATCTGGCGACATG
AAATTTTAGATGCAGATGGCATTTGTTCTCCAGGTGAGAAAGTGGAAAACAAACAGGTGCTTGTAAACAAGTCCATGCCC
ACAGTGACACAGATTCCTTTGGAAGGGAGCAACGTGCCACAGCAACCACAGTATAAAGATGTGCCTATCAC
Sequence Type mRNA
Unitrap ID UNI6885

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84158346..84159811 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034453 (Polr3b) NM_027423 polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]

 
Come back to gene ENSMUSG00000034453


For any suggestions or comments, please send an email to unitrap@crg.es