Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST173159
Clone ID OST173159
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST173159
Sequence
TGAGCACAGCCTATGCCCCTGAGGCTACCGACTATGACCTCCGAGTGCTATTGCGCTTCCCCCAGCGAGTGAAAAACCAA
GGCACAGCGGACTTTCTCCCCAACCGGCCACGCCACACCTGGGAGTGGCATAGCTGTCACCAACATTACCACAGCATGGA
CGAGTTCAGCCACTACGACCTGCTTGATGCATCCACGGGCAAGAAGGTAGCCGAGGGACACAAGGCCAGCTTCTGCCTGG
AGGACAGCACCTGTGACTTCGGCAACCTCAAGCGCTATGCCTGCACCTCTCACACGCAGGGCCTGAGTCCAGGCTGCTAT
GACACATACAATGCGGACATTGACTGCCAGTGGATCGACATAACTGATGTGCAGCCTGGGAACTACATCCTCAAGGNGCA
CGTGAACCCCAAGTACATTGTTCTGGGAGTCTGACTTCACCAACAACGNGGGNGAGATGCAACATCCACTACACAGGT
Sequence Type mRNA
Unitrap ID UNI21804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58138597..58142305 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es