Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST172939
Clone ID OST172939
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST172939
Sequence
AACTGAGTGGTAGTCNCTCTTCTAAAACTTTTAAACCAAAGAAGAACATACCAGAGGGGTCTCACCAGTATGAACTCTTA
AAGCATGCAGGAAGCCACACTGGGCAGCGGCAACCTACGGATGGCTGTCATGCTTCCCGAGGGAGAGGATCTGAATGAGT
GGGTTGCAGTTAACACTGTGGATTTTTTCAATCAAATCAATATGCTTTATGGAACCAT
Sequence Type mRNA
Unitrap ID UNI20969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89172327..89174124 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006262 (Mobkl1a) NM_026735 MOB1, Mps One Binder kinase activator-like 1A (yeast) Gene [Source:MGI (curated);Acc:Mobkl1a-001]

 
Come back to gene ENSMUSG00000006262


For any suggestions or comments, please send an email to unitrap@crg.es